42 – The number ruling the world

Number 42 is it really so important, powerful and mysterious? Let’s start with the universe. Dutch astronomer Jorg Rachen, participating in the project of the space observatory “Plank”, and the German philosopher Ute Gahlings (Ute Gahlings) published a work in which it is pointed out that the basic parameters of the standard cosmological model can be obtained from combining only three numbers: 23, 42 and the number Pi.

The authors formulated a concept that was called conspirological cosmology, because the regularities they revealed led them to the idea that the main parameters of our universe are not accidental, but are set by some higher forces involved in its creation.

Strictly speaking, modern astrophysics follows the history of the Universe quite confidently until practically the moment of the Big Bang that gave it its start. However, what was before (if, of course, you can use the term “before”, for time as such in our understanding then did not exist), we do not know. And we simply do not have either physical or methodological tools to find out. Moreover, physics and astrophysics are able to answer the question “How?”. With the question “Why?” – much more difficult.

Why are such fundamental constants as Planck’s constant or electron charge exactly such, and not other values? Why is the speed of light in the void exactly 300 thousand km / s? In cosmology there is a so-called. The anthropic principle, in accordance with which it is meaningless to seek explanations for certain features of the universe we observe; They are just that, because we have managed to appear in the universe precisely with such properties. And we simply do not see other universes with other characteristics (it must be said that in the last two decades there have appeared quite a lot of theoretical work that seriously explores the possibility of a plurality of universes).

As for the question “Why?”, Then no natural sciences are in principle able to give an answer to it – it belongs to the competence of philosophy. Why was the universe created, if it was created? Different philosophers and theologians have many options for an answer.

Meanwhile, no known to date science facts do not contradict the hypothesis that it was created as a result of a purposeful act of creation, although there is no evidence to the contrary. The famous British astrophysicist Stephen Hawking, for many years chained to a wheelchair, is currently working on creating a comprehensive “M-theory”, or “Theory of Everything”, designed to fill the gaps left by superstring theory and Einstein’s general theory of relativity. At one time Hawking came to the conclusion that to start the process of forming our universe, God (or some kind of almighty, by our standards, reasonable power, which we could call it) is absolutely not necessary.

Nevertheless, recently, Bank of America Merrill Lynch in an information note for his clients put forward a theory that with the probability of 20% to 50%, our entire universe and humanity in particular are subject to computer modeling, i.e. Exist in a kind of matrix, and this was not an April Fool’s joke. Ilon Mask is more categorical: according to his point of view, the chance that we exist in objective reality does not exceed one by several billion.

So, what is the “conspiracy cosmogony” of Rachen and Gahlings?

The authors begin with the definition of a set of basic conspiracy constants. First of all they allocate the number 23, equal to the sum of three consecutive primes: 5 + 7 + 11. In addition, this is the only integer that is in the interval from Pi to the power of e (~ 22.4) to e in the power Pi (~ 23.1).

The next number they allocate is 42. If you write it in the binary system, you get 101010 – pair 10 three times, which leads to 23. By combining these two numbers with the number Pi, it turns out that you can get a set of basic parameters of the modern cosmological model. For example, the proportion of baryonic matter in the universe is 42/1000 of the total amount of matter. The value of the Hubble constant, which characterizes the rate of expansion of the Universe H0 = 72 (km / s) / Mpc, is almost equal to 23 * Pi. The share of dark matter is 23 percent, and the share of mysterious dark energy is 72 percent of the total gravitational energy of the universe, which again is 23 * Pi.

The product 23 * 42 = 966, called the super-conspirological constant, clearly corresponds to a value of 0.966, close to the exponent of the spectrum of the initial perturbations of the matter density, which, as the results of the Planck mission showed, is slightly different from unity.

The authors come to the conclusion that such coincidences are hardly accidental and that either our universe was created by some reasonable force, or the Universe in the usual sense of the word does not exist at all and the whole world is nothing more than an illusion. For example, a computer program created for some special purposes, known only to its creators, whom the authors call the capacious word “they”. Which quite coincides with the warning of Bank of America Merrill Lynch and the point of view of Ilona Mask.

If we assume for a moment that the theory of Rachean and Gahlings is true, the meaning of the answer, which is not understood by the characters of Douglas Adams, becomes clearer. Indeed, the number 42 – the main constant, embedded in the structure of our universe by its hypothetical creators. With this approach, it is no longer surprising that the number of cases in which the number plays a significant role in our life and death, or even in the destinies of the whole world, is excessively frequent, from the point of view of probability theory. After all, probability theory investigates random events, and this number was embedded in the fabric of the universe, which is called “in design.”

The rainbow appears when the light refracts and returns to the observer at an angle of 42 degrees. The rainbow arc has a radius of 42 degrees. At a height of 42 degrees, the rainbow disappears.

The great Orion Nebula is the brightest diffuse object visible in the sky with the unaided eye, known since antiquity and very strongly stimulated in its time the development of astronomy. French astronomer XVII century Charles Messier, who created the first ever catalog of nebulae and assigned it number 42, we note, clearly did not know anything about the theory of Rachel and Gahlings.

TTTAATTGAAAGAAGTTAATTGAATGAAAATGATCAACTAAG – this is how the DNA sequence is common to all vertebrates. There are 42 characters in this record.

On all mercury medical thermometers the mark “42” is marked in red. It is at this temperature that the blood protein turns off and the person dies.

From the natural sciences we turn to theology and philosophy. The special significance of the number 42 can be discerned by how often it appears in all religions and how serious a role it plays in them.

The ancient Egyptians associated the life of the god Osiris with two numbers – 28 (the number of days in the lunar month) and 14 (according to legend, the body of Osiris was divided into 14 parts, which is an allegory reflecting the decrease of the moon from full moon to new moon in 14 days). In sum, these two numbers give 42.

In the Egyptian Book of the Dead it is said: on mortal judgment, people will answer for their 42 mortal sins before 42 gods.

The prayer “Ana ba koah” consists of seven lines, and in each line there are six words. If you combine the first letters of all these words, you get the name of God. To study Kabbalah is allowed only after reaching 42 years.

Before retiring to nirvana, Buddha answered the questions for 42 years.

According to the Scriptures, before the fateful kiss in the Garden of Gethsemane, Jesus preached three and a half years, that is, 42 months. And in the family he had: “There are fourteen generations from Abraham to David, and from David to the captivity to Babylon there are fourteen generations, and from the migration to Babylon to Christ are fourteen generations” (Matthew 1:17). Three times fourteen – this is 42 genus.

The first printed book, the Gutenberg Bible, contains exactly 42 lines on each page.

The destinies of rulers, war and peace, as it turns out, are also closely related to this number.
Hitler, undoubtedly, was one of the most hated characters in all of history. Until the moment when the Soviet army led the fighting for Berlin to commit suicide, a total of 42 unsuccessful attempts were committed against Hitler.

In the camp of the winners after the beginning of the Cold War and a number of the first nuclear tests in the center of Moscow, under the Tagansky Hill, a strategic anti-nuclear shelter was built, designed for the first persons of the state. Its location was chosen so that in the event of an alarm, the leadership of the USSR managed to reach and continue to lead the army and the state in the conditions of nuclear war. The order to create the bunker was signed personally by I.V. Stalin, and the object itself received the designation GO-42 (now there is a popular museum, open for sightseeing visits).

The architect of the current crisis of global crisis, the main conductor of globalization ideas and the man who launched around the world a string of “humanitarian bombing” and “forcible establishment of democracy,” Bill Clinton was the 42nd governor of Arizona and the 42nd president of the United States.

Moscow events of October 1993, when Boris Yeltsin shot the building of the Supreme Soviet of the RSFSR from tanks and actually made an unconstitutional coup d’etat, marked the beginning of the infamous “dashing 90-m” – oligarchic and bandit. The ideological contours of this path of development of the country were outlined in the appeal of liberal cultural figures, published in the newspaper Izvestia. This appeal is known as “Letter 42” – according to the number of writers who signed it.